ID: 1096952946_1096952948

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1096952946 1096952948
Species Human (GRCh38) Human (GRCh38)
Location 12:55494178-55494200 12:55494216-55494238
Sequence CCAAGAAAATATTAGATATTTAT AATTACCTATAGCAATAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 96, 4: 1005} {0: 1, 1: 0, 2: 2, 3: 8, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!