ID: 1097058664_1097058666

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1097058664 1097058666
Species Human (GRCh38) Human (GRCh38)
Location 12:56266597-56266619 12:56266627-56266649
Sequence CCTTTCATATATACATTTATCCT ATGTCCCTCTAGAGAACCTAAGG
Strand - +
Off-target summary {0: 11, 1: 368, 2: 730, 3: 669, 4: 1227} {0: 1, 1: 0, 2: 2, 3: 8, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!