ID: 1097076998_1097077002

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1097076998 1097077002
Species Human (GRCh38) Human (GRCh38)
Location 12:56402414-56402436 12:56402453-56402475
Sequence CCTGCCATCTTCTGGCGATAACT ACAGCTCTTGACCTGTTACTGGG
Strand - +
Off-target summary No data {0: 5, 1: 184, 2: 199, 3: 165, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!