ID: 1097079800_1097079810

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1097079800 1097079810
Species Human (GRCh38) Human (GRCh38)
Location 12:56421726-56421748 12:56421779-56421801
Sequence CCATCTGAGTCCCGGAATTCCTC CCCCGTCCACAGTACAATATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 133} {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!