ID: 1097081833_1097081838

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1097081833 1097081838
Species Human (GRCh38) Human (GRCh38)
Location 12:56437468-56437490 12:56437514-56437536
Sequence CCCAGGAGTGCAGTGGTACAATC CAGAATACAGAAAATGAGGCAGG
Strand - +
Off-target summary {0: 7, 1: 38, 2: 159, 3: 302, 4: 499} {0: 1, 1: 0, 2: 5, 3: 123, 4: 2969}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!