ID: 1097119684_1097119689

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1097119684 1097119689
Species Human (GRCh38) Human (GRCh38)
Location 12:56721544-56721566 12:56721593-56721615
Sequence CCTCCTAGGAAACACTGGAGTTT CAGGATTAGATAAAGGTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 141} {0: 1, 1: 0, 2: 1, 3: 10, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!