ID: 1097134601_1097134611

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1097134601 1097134611
Species Human (GRCh38) Human (GRCh38)
Location 12:56841225-56841247 12:56841261-56841283
Sequence CCAGCGCAGAAGGTAGTACAGGC CAGGGAGAGTCCCATGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 5, 4: 337} {0: 1, 1: 0, 2: 1, 3: 41, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!