ID: 1097185884_1097185894

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1097185884 1097185894
Species Human (GRCh38) Human (GRCh38)
Location 12:57196070-57196092 12:57196118-57196140
Sequence CCTCCGCCCCTCCGCAGAGCACA GTGCAGCAGTGGGCGCTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 256} {0: 1, 1: 0, 2: 3, 3: 24, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!