ID: 1097232825_1097232829

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1097232825 1097232829
Species Human (GRCh38) Human (GRCh38)
Location 12:57522735-57522757 12:57522749-57522771
Sequence CCTGCGGCGGCGGCTGCGGCAGC TGCGGCAGCGACGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 118, 3: 302, 4: 856} {0: 1, 1: 6, 2: 112, 3: 1601, 4: 2533}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!