ID: 1097232825_1097232834

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1097232825 1097232834
Species Human (GRCh38) Human (GRCh38)
Location 12:57522735-57522757 12:57522786-57522808
Sequence CCTGCGGCGGCGGCTGCGGCAGC TGCGCAGTGCCTTCTGGGAACGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 118, 3: 302, 4: 856} {0: 1, 1: 0, 2: 1, 3: 21, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!