ID: 1097240035_1097240040

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1097240035 1097240040
Species Human (GRCh38) Human (GRCh38)
Location 12:57568866-57568888 12:57568879-57568901
Sequence CCTTCCTTCCTCCGTGGACTGAG GTGGACTGAGCCCTGGAACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 257} {0: 1, 1: 0, 2: 0, 3: 14, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!