ID: 1097265513_1097265525

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1097265513 1097265525
Species Human (GRCh38) Human (GRCh38)
Location 12:57742179-57742201 12:57742225-57742247
Sequence CCGCCCCTGCCCGCCCTTCCGTC TGAGTTTCAAACCCACAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 99, 4: 1240} {0: 1, 1: 0, 2: 2, 3: 18, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!