ID: 1097270767_1097270777

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1097270767 1097270777
Species Human (GRCh38) Human (GRCh38)
Location 12:57772565-57772587 12:57772591-57772613
Sequence CCTCCAGGAAATCGAACTGGAGG GAGGGCAAACTCAGGGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98} {0: 1, 1: 0, 2: 1, 3: 35, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!