ID: 1097446475_1097446486

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1097446475 1097446486
Species Human (GRCh38) Human (GRCh38)
Location 12:59678590-59678612 12:59678636-59678658
Sequence CCAGGGTTTTTATGGGCTTCAGA GCTCATGGGCAGCCACGGGTAGG
Strand - +
Off-target summary {0: 22, 1: 50, 2: 102, 3: 192, 4: 380} {0: 1, 1: 0, 2: 10, 3: 82, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!