ID: 1097637346_1097637350

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1097637346 1097637350
Species Human (GRCh38) Human (GRCh38)
Location 12:62138947-62138969 12:62138978-62139000
Sequence CCACCCAGAGATCAGAAATAAGG ACAGTTTCCTTCCTTTTCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 211} {0: 1, 1: 0, 2: 9, 3: 55, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!