ID: 1097682658_1097682662

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1097682658 1097682662
Species Human (GRCh38) Human (GRCh38)
Location 12:62663472-62663494 12:62663492-62663514
Sequence CCACCATGCCAGCCAAAATTTGC TGCATTTCTAACAAGTTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 1335} {0: 180, 1: 761, 2: 1549, 3: 2220, 4: 2482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!