ID: 1097691171_1097691175

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1097691171 1097691175
Species Human (GRCh38) Human (GRCh38)
Location 12:62735898-62735920 12:62735915-62735937
Sequence CCTGGAAATGGAAGGTAGTTCTC GTTCTCTGTGGCTGGAGCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 251} {0: 1, 1: 1, 2: 5, 3: 33, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!