ID: 1097697190_1097697199

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1097697190 1097697199
Species Human (GRCh38) Human (GRCh38)
Location 12:62786322-62786344 12:62786375-62786397
Sequence CCCTGAGGCGGGAGAGGAAAGGA CTGTCCCCATCCTGGAGGTACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 367} {0: 1, 1: 1, 2: 11, 3: 38, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!