ID: 1097732612_1097732617

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1097732612 1097732617
Species Human (GRCh38) Human (GRCh38)
Location 12:63146661-63146683 12:63146707-63146729
Sequence CCTCTCACCTTCAGCATCTCAGT ATATGTGAGGAACCAAAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 21, 4: 292} {0: 1, 1: 0, 2: 4, 3: 28, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!