ID: 1097733066_1097733074

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1097733066 1097733074
Species Human (GRCh38) Human (GRCh38)
Location 12:63151211-63151233 12:63151255-63151277
Sequence CCGCTCCCTGGAGTTTTATTTTT TGTCCTCTGCATCACTGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 76, 4: 868} {0: 1, 1: 0, 2: 4, 3: 43, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!