ID: 1097772825_1097772832

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1097772825 1097772832
Species Human (GRCh38) Human (GRCh38)
Location 12:63608766-63608788 12:63608807-63608829
Sequence CCCTGTTCCATCTCAGCTATCAC ACTGTTGATTTTTCAAATTTTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 0, 3: 12, 4: 210} {0: 2, 1: 2, 2: 5, 3: 65, 4: 795}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!