|
Left Crispr |
Right Crispr |
| Crispr ID |
1097840840 |
1097840854 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:64319958-64319980
|
12:64320005-64320027
|
| Sequence |
CCGTCCACCACTCCTGTTTGCCG |
CCATCCCTCCGGATCCGGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 62, 2: 127, 3: 74, 4: 208} |
{0: 16, 1: 92, 2: 154, 3: 148, 4: 128} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|