ID: 1098002728_1098002730

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1098002728 1098002730
Species Human (GRCh38) Human (GRCh38)
Location 12:65962159-65962181 12:65962202-65962224
Sequence CCGTCTTATGAGACAATGTGCAG CTCACTAACGACGCTTTTATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 109} {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!