ID: 1098018075_1098018080

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1098018075 1098018080
Species Human (GRCh38) Human (GRCh38)
Location 12:66127385-66127407 12:66127438-66127460
Sequence CCATGCTAAGGGAAATAAGCCAG TTATAAGAAATATTCAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 56, 3: 97, 4: 293} {0: 1, 1: 1, 2: 32, 3: 220, 4: 1620}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!