ID: 1098018358_1098018367

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1098018358 1098018367
Species Human (GRCh38) Human (GRCh38)
Location 12:66130258-66130280 12:66130273-66130295
Sequence CCCCCGACCCTCTCCCCAGACTG CCAGACTGTAGACTCCACGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 441} {0: 1, 1: 0, 2: 9, 3: 67, 4: 458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!