ID: 1098045801_1098045808

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1098045801 1098045808
Species Human (GRCh38) Human (GRCh38)
Location 12:66399199-66399221 12:66399217-66399239
Sequence CCTCCCTCCACCGTGCCAGGAGC GGAGCGTTGAGTCAGCTTTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 327} {0: 1, 1: 0, 2: 0, 3: 11, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!