ID: 1098123459_1098123463

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1098123459 1098123463
Species Human (GRCh38) Human (GRCh38)
Location 12:67266758-67266780 12:67266788-67266810
Sequence CCTCTGCTTGAGGATTGTGGGTC TGAAGCAGCTTGGAAACCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 105} {0: 1, 1: 0, 2: 3, 3: 17, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!