ID: 1098342947_1098342956

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1098342947 1098342956
Species Human (GRCh38) Human (GRCh38)
Location 12:69470519-69470541 12:69470555-69470577
Sequence CCTGGGCGGACGGTGAGTGGCTA GGACGGCCGCGGGCCCGCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 38} {0: 1, 1: 0, 2: 0, 3: 13, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!