ID: 1098386260_1098386264

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1098386260 1098386264
Species Human (GRCh38) Human (GRCh38)
Location 12:69922011-69922033 12:69922041-69922063
Sequence CCAAGGGAAAAAAAAGAGTATCA CAGTGAGGATGGAGAGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 599} {0: 2, 1: 3, 2: 30, 3: 242, 4: 1357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!