ID: 1098499049_1098499052

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1098499049 1098499052
Species Human (GRCh38) Human (GRCh38)
Location 12:71169120-71169142 12:71169156-71169178
Sequence CCTAAGTTAGGTTTTCAGTCTTG CTAGGCTGCAGTTAGTCATAAGG
Strand - +
Off-target summary {0: 22, 1: 122, 2: 152, 3: 111, 4: 245} {0: 1, 1: 0, 2: 1, 3: 14, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!