ID: 1098500792_1098500795

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1098500792 1098500795
Species Human (GRCh38) Human (GRCh38)
Location 12:71189286-71189308 12:71189325-71189347
Sequence CCAACAAGTATCTGCTGCATTCA TAAGGATTCACATAAACTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 157} {0: 1, 1: 23, 2: 345, 3: 482, 4: 536}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!