ID: 1098502563_1098502568

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1098502563 1098502568
Species Human (GRCh38) Human (GRCh38)
Location 12:71210505-71210527 12:71210546-71210568
Sequence CCTTTATTCTTCTAGAAGGACAC TCCATGGTTTAAAATAAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 193} {0: 1, 1: 20, 2: 26, 3: 67, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!