ID: 1098506687_1098506688

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1098506687 1098506688
Species Human (GRCh38) Human (GRCh38)
Location 12:71260637-71260659 12:71260658-71260680
Sequence CCAGCAAGAGAAAATAAATGAAG AGAAGTAACCAGAAGAAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 571} {0: 1, 1: 0, 2: 1, 3: 32, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!