ID: 1098541549_1098541554

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1098541549 1098541554
Species Human (GRCh38) Human (GRCh38)
Location 12:71663424-71663446 12:71663438-71663460
Sequence CCCGGGCCGAGTGAGGAGGCCTT GGAGGCCTTCGCCGCGGATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 159} {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!