ID: 1098571230_1098571232

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1098571230 1098571232
Species Human (GRCh38) Human (GRCh38)
Location 12:71989557-71989579 12:71989580-71989602
Sequence CCTAAAGAAATATGTTTTAAAAG ACAGATGTGCAGATTTTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 149, 4: 1405} {0: 1, 1: 0, 2: 3, 3: 15, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!