ID: 1098716125_1098716130

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1098716125 1098716130
Species Human (GRCh38) Human (GRCh38)
Location 12:73830090-73830112 12:73830108-73830130
Sequence CCCTCAGTCTGCACTGATGGCCT GGCCTCGCGGGGAGTTCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 53, 3: 128, 4: 292} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!