ID: 1098749845_1098749847

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1098749845 1098749847
Species Human (GRCh38) Human (GRCh38)
Location 12:74279564-74279586 12:74279612-74279634
Sequence CCTGTCATCTTCTGCAGATAACT AGCCTGTTACTGAGCTTTTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!