ID: 1098801069_1098801075

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1098801069 1098801075
Species Human (GRCh38) Human (GRCh38)
Location 12:74958907-74958929 12:74958938-74958960
Sequence CCCAAACCACTTCTCCATGTTAT ACTGAAGGGCAGCCATTTCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!