ID: 1098897479_1098897487

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1098897479 1098897487
Species Human (GRCh38) Human (GRCh38)
Location 12:76080755-76080777 12:76080789-76080811
Sequence CCTCTAAAACTCAAGTTGAAATT GTGGCAGCACTGAGAGATGGGGG
Strand - +
Off-target summary {0: 6, 1: 55, 2: 437, 3: 1438, 4: 3277} {0: 1, 1: 0, 2: 4, 3: 24, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!