ID: 1098963400_1098963403

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1098963400 1098963403
Species Human (GRCh38) Human (GRCh38)
Location 12:76762532-76762554 12:76762562-76762584
Sequence CCCTCTTTGAGTAACTGCTGCTC TGTTGCTACTTTATTACTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 190} {0: 1, 1: 0, 2: 2, 3: 6, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!