ID: 1098990373_1098990376

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1098990373 1098990376
Species Human (GRCh38) Human (GRCh38)
Location 12:77059299-77059321 12:77059320-77059342
Sequence CCTTGCTCCATCTGTCTGTCCTG TGCTATGCTGACAGCATATACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 420} {0: 1, 1: 0, 2: 0, 3: 3, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!