ID: 1099075900_1099075902

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1099075900 1099075902
Species Human (GRCh38) Human (GRCh38)
Location 12:78107853-78107875 12:78107872-78107894
Sequence CCACCAGAGAAATCTAACTAACC AACCACAATGACAAACAATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154} {0: 2, 1: 2, 2: 17, 3: 157, 4: 1253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!