ID: 1099148788_1099148792

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1099148788 1099148792
Species Human (GRCh38) Human (GRCh38)
Location 12:79081849-79081871 12:79081888-79081910
Sequence CCCCAGGAGCTTCTAAGAGCACA TTGAATTCATCTCACTGTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 227} {0: 1, 1: 0, 2: 0, 3: 14, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!