ID: 1099283485_1099283490

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1099283485 1099283490
Species Human (GRCh38) Human (GRCh38)
Location 12:80684212-80684234 12:80684253-80684275
Sequence CCGCGGTGAAGTGCAGGAGGTTT GGCGGTGTTTGATTTACATAGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 15, 3: 33, 4: 139} {0: 4, 1: 94, 2: 364, 3: 473, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!