ID: 1099293088_1099293092

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1099293088 1099293092
Species Human (GRCh38) Human (GRCh38)
Location 12:80796453-80796475 12:80796500-80796522
Sequence CCAGTGAATGATATTTTCTGAAA CTATGGGAATATATTAAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 382} {0: 1, 1: 0, 2: 0, 3: 12, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!