ID: 1099362640_1099362645

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1099362640 1099362645
Species Human (GRCh38) Human (GRCh38)
Location 12:81724752-81724774 12:81724779-81724801
Sequence CCATATCTCTGCTATAGTGAATA TGCAATAAACATAAGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 23, 2: 710, 3: 6289, 4: 29554} {0: 1, 1: 0, 2: 3, 3: 62, 4: 490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!