ID: 1099720316_1099720318

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1099720316 1099720318
Species Human (GRCh38) Human (GRCh38)
Location 12:86353920-86353942 12:86353937-86353959
Sequence CCGGTATTTAGAGAGTACAAGGT CAAGGTAATCAAGAAGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 535} {0: 1, 1: 0, 2: 1, 3: 28, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!