ID: 1099973895_1099973901

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1099973895 1099973901
Species Human (GRCh38) Human (GRCh38)
Location 12:89526079-89526101 12:89526092-89526114
Sequence CCCCGAGACACCGCCAGCCCTGT CCAGCCCTGTAAAGAGAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 112} {0: 1, 1: 0, 2: 0, 3: 21, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!