ID: 1100244144_1100244147

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1100244144 1100244147
Species Human (GRCh38) Human (GRCh38)
Location 12:92739520-92739542 12:92739551-92739573
Sequence CCCACTGTAAGCTGTCCAAGCTT GACATTTCCTGTTTAAGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143} {0: 1, 1: 0, 2: 3, 3: 49, 4: 854}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!