ID: 1100344908_1100344910

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1100344908 1100344910
Species Human (GRCh38) Human (GRCh38)
Location 12:93719053-93719075 12:93719074-93719096
Sequence CCTGGCTGACTTTCTCACTGTTA TAAGTATGATGTTAGCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 277} {0: 6, 1: 17, 2: 74, 3: 172, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!